Molecules that serve similar functions for different organisms

Integrated Analysis of miRNAs and DNA Methylation identifies miR-132-3p as a Tumor suppressor

Integrated Analysis of miRNAs and DNA Methylation identifies miR-132-3p as a Tumor suppressor

Built-in evaluation of miRNAs and DNA methylation identifies miR-132-3p as a tumor suppressor in lung adenocarcinoma

Background: Aberrant miRNA expression and DNA methylation are two main epigenetic occasions in lung adenocarcinoma (LUAD). We carried out a mixed evaluation of the molecular adjustments in LUAD.
Strategies: We analyzed differentially expressed miRNAs and methylated CpG loci in 489 LUAD tissues versus 49 regular lung tissues of the Most cancers Genome Atlas (TCGA). The outcomes had been validated in cell traces and xenograft mouse fashions and extra pairs of 36 LUAD and 36 regular lung tissues.
Outcomes: A complete of 125 differentially expressed miRNAs and 145 differentially methylated CpG loci had been recognized within the LUAD versus regular lung tissues of TCGA information. Expression of the 22 miRNAs was inversely correlated with the 47 differentially methylated websites situated within the miRNAs.
Molecular and mobile perform evaluation confirmed that the abnormally methylated miRNAs had been primarily concerned in cell-to-cell signaling and interplay in airway cells. The DNA methylation standing and altered expressions of miRNAs and their goal genes had been confirmed in 36 pairs of lung tumor and noncancerous lung tissues. Moreover, aberrant miRNA expressions or DNA methylations alone might be concerned in tumorigenesis of LUAD through completely different pathways.
As well as, elevated miR-132-3p expression, diminished expression of its focused gene (ZEB2), and decreased cell proliferation was noticed in lung most cancers cells handled with DNA methyltransferase inhibitor. Furthermore, in vitro and in vivo analyses confirmed that miR-132-3p-3p downregulation through DNA methylation promoted tumorigenicity of lung most cancers by immediately regulating ZEB2.
Conclusions: The interplay between two epigenetic aberrations might have necessary capabilities in LUAD. miR-132-3p may act as a tumor suppressor within the tumorigenicity of LUAD.
Key factors: SIGNIFICANT FINDINGS OF THE STUDY: Systemically investigating relationship between aberrant miRNA expression and DNA methylation in lung most cancers might enhance understanding of lung tumorigenesis and develop diagnostic and therapeutic targets.
What this research provides: Three types of relationships between the 2 epigenetic adjustments are outlined. miR-132-3p is additional recognized as a tumor suppressor in lung most cancers.
Key phrases: DNA methylation; epigenetics; lung most cancers; microRNA

cDNA from Dog Normal Tissue: Kidney

C1734142 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Kidney

C1234142 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Kidney

C1534142 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Kidney

C1534142-Cy 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Adipose

C1434003 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Bladder

C1434010 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Brain

C1434035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Colon

C1434090 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Heart

C1434122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Liver

C1434149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Lung

C1434152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Placenta

C1434200 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Rectum

C1434206 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Spleen

C1434246 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Stomach

C1434248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Testis

C1434260 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney

C1235142 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Kidney

C1236142Dia 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Matching Pair - cDNA from Human Primary Tumor and Normal Tissue: Kidney

C8235142-PP 10 reactions x2
EUR 499
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Skeletal Muscle

C1434171 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Small Intestine

C1434226 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from Rat Normal Tissue: Kidney

D1434142 100 ug
EUR 282
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Rat Normal Tissue: Kidney

R1434142-50 50 ug
EUR 152
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Adipose

C1334003 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Bladder

C1334010 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Brain

C1334035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Colon

C1334090 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Heart

C1334122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Liver

C1334149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Lung

C1334152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Placenta

C1334200 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Rectum

C1334206 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Spleen

C1334246 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Stomach

C1334248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Mouse Normal Tissue: Testis

C1334260 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Bladder

C1734010 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Brain

C1734035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Cecum

C1734089 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Esophagus

C1734106 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Heart

C1734122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Liver

C1734149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Lung

C1734152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Trachea

C1734160 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Pancreas

C1734188 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Rectum

C1734206 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Stomach

C1734248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dog Normal Tissue: Testis

C1734260 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Monkey (Cynomolgus) cDNA Normal Tissue: Liver

MC34-149 10 rxn
EUR 415

Monkey (Cynomolgus) cDNA Normal Tissue: Pancreas

MC34-188 10 rxn
EUR 415

Monkey (Cynomolgus) cDNA Normal Tissue: Spleen

MC34-246 10 rxn
EUR 415

Rat Kidney Tissue Preparation Buffer 2: Normal Kidney Epithelial Cells

9-80263 1 x 100 ml Ask for price

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Adipose

C1234003-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Adrenal

C1234004 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Bladder

C1234010 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Brain

C1234035 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Breast

C1234086 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Colon

C1234090 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Esophagus

C1234106 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Heart

C1234122 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Liver

C1234149 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Lung

C1234152 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Trachea

C1234160-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Ovary

C1234183 40 reactions
EUR 939
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Pancreas

C1234188 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Placenta

C1234200 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Prostate

C1234201 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Rectum

C1234206 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Skin

C1234218 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Spleen

C1234246 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Stomach

C1234248 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Design, synthesis, DNA binding research and analysis of anticancer potential of novel substituted biscarbazole derivatives in opposition to human glioma U87 MG cell line
On this analysis paper, we report the design and synthesis of novel substituted biscarbazole derivatives which had been characterised by 1H and 13C NMR, excessive decision mass spectroscopy (HRMS). The SAR research of the compounds is reported primarily based on completely different substituents and their positions within the biscarbazole scaffold.
In vitro cytotoxicity of the compounds was evaluated in opposition to human glioma U87 MG cell line by MTT assay for 24 h. The IC50 values of the compounds (30-35, 48-53 and 54-62) had been calculated on the focus vary from 1.00 µM to 500 µM. The compound 34 confirmed essentially the most vital in vitro cytotoxicity (IC50 = 3.9 µM) in opposition to human glioma U87 MG cell line and was discovered to be higher than customary medicine used for the therapy of mind tumors akin to temozolomide (IC50 = 100 µM) and carmustine (IC50 = 18.2 µM) respectively.
To find out the mode of binding of compound 34 with CT-DNA, numerous biophysical methods like UV-spectrophotometer, fluorescence, round dichroism, viscosity, topoisomerase assay and molecular docking evaluation, had been used. Our outcomes demonstrated groove binding mode of interplay of the compound 34 with CT-DNA with a believable static bio-molecular quenching fee fixed (Kq) 1.7 × 1012 M-1 s-1. The research of biscarbazole derivatives are anticipated to develop potential novel anticancer brokers in opposition to mind tumors.
Key phrases: BCNU (Carmustine-Bis-Chloro ethyl-NitrosoUrea); CCNU(Lomustine-CyclohexylChloroethylNitrosoUrea); CD (Round Dichroism); CT-DNA (Calf thymus-deoxyribonucleic acid); Compound 34 (bis((6-methoxy-1,4-dimethyl-9H-carbazol-3-yl)methyl) amine); EtBr (Ethidium Bromide); GBM (Glioblastoma); Half most inhibitory focus (IC(50)); Human glioma U87 MG cell line; MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide); TMZ (Temozolomide).


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNAJC11 Blocking Peptide

DF12948-BP 1mg
EUR 195

DNAJC11 cloning plasmid

CSB-CL868329HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggcgacggccttgagcgaggaggagctggacaatgaagactattactcgttgctgaacgtgcgcagggaggcctcttctgaagagctgaaagctgcctaccggaggctctgtatgctctaccatccagacaagcacagagacccagagctcaagtcacaggcggaacgactgt
  • Show more
Description: A cloning plasmid for the DNAJC11 gene.

DNAJC11 cloning plasmid

CSB-CL868329HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Sequence: atggcgacggccttgagcgaggaggagctggacaatgaagactattactcgttgctgaacgtgcgcagggaggcctcttctgaagagctgaaagctgcctaccggaggctctgtatgctctaccatccagacaagcacagagacccagagctcaagtcacaggcggaacgactgt
  • Show more
Description: A cloning plasmid for the DNAJC11 gene.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280


EF009166 96 Tests
EUR 689

Human DNAJC11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DNAJC11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNAJC11 Recombinant Protein (Human)

RP009565 100 ug Ask for price

DNAJC11 Recombinant Protein (Human)

RP009568 100 ug Ask for price

DNAJC11 Recombinant Protein (Rat)

RP198329 100 ug Ask for price

DNAJC11 Recombinant Protein (Mouse)

RP129536 100 ug Ask for price

Polyclonal Dnajc11 antibody - C-terminal region

APR15777G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dnajc11 - C-terminal region. This antibody is tested and proven to work in the following applications:

Dnajc11 ORF Vector (Rat) (pORF)

ORF066111 1.0 ug DNA
EUR 506

DNAJC11 ORF Vector (Human) (pORF)

ORF003189 1.0 ug DNA
EUR 95

DNAJC11 ORF Vector (Human) (pORF)

ORF003190 1.0 ug DNA
EUR 95

Dnajc11 ORF Vector (Mouse) (pORF)

ORF043180 1.0 ug DNA
EUR 506

Dnajc11 sgRNA CRISPR Lentivector set (Rat)

K6097801 3 x 1.0 ug
EUR 339

DNAJC11 sgRNA CRISPR Lentivector set (Human)

K0615901 3 x 1.0 ug
EUR 339

Dnajc11 sgRNA CRISPR Lentivector set (Mouse)

K4585501 3 x 1.0 ug
EUR 339

DnaJ (Hsp40) Homolog, Subfamily C, Member 11 (DNAJC11) Antibody

abx025736-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily C, Member 11 (DNAJC11) Antibody

abx025736-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily C, Member 11 (DNAJC11) Antibody

abx232458-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Dnajc11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6097802 1.0 ug DNA
EUR 154

Dnajc11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6097803 1.0 ug DNA
EUR 154

Dnajc11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6097804 1.0 ug DNA
EUR 154

DNAJC11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0615902 1.0 ug DNA
EUR 154

DNAJC11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0615903 1.0 ug DNA
EUR 154

DNAJC11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0615904 1.0 ug DNA
EUR 154

Dnajc11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4585502 1.0 ug DNA
EUR 154

Dnajc11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4585503 1.0 ug DNA
EUR 154

Dnajc11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4585504 1.0 ug DNA
EUR 154

DNAJC11 Protein Vector (Mouse) (pPB-C-His)

PV172718 500 ng
EUR 603

DNAJC11 Protein Vector (Mouse) (pPB-N-His)

PV172719 500 ng
EUR 603

DNAJC11 Protein Vector (Mouse) (pPM-C-HA)

PV172720 500 ng
EUR 603

DNAJC11 Protein Vector (Mouse) (pPM-C-His)

PV172721 500 ng
EUR 603

DNAJC11 Protein Vector (Rat) (pPB-C-His)

PV264442 500 ng
EUR 603

DNAJC11 Protein Vector (Rat) (pPB-N-His)

PV264443 500 ng
EUR 603

DNAJC11 Protein Vector (Rat) (pPM-C-HA)

PV264444 500 ng
EUR 603

DNAJC11 Protein Vector (Rat) (pPM-C-His)

PV264445 500 ng
EUR 603

DNAJC11 Protein Vector (Human) (pPB-C-His)

PV012753 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPB-N-His)

PV012754 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPM-C-HA)

PV012755 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPM-C-His)

PV012756 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPB-C-His)

PV012757 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPB-N-His)

PV012758 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPM-C-HA)

PV012759 500 ng
EUR 329

DNAJC11 Protein Vector (Human) (pPM-C-His)

PV012760 500 ng
EUR 329

Dnajc11 3'UTR GFP Stable Cell Line

TU155261 1.0 ml Ask for price

Dnajc11 3'UTR Luciferase Stable Cell Line

TU105261 1.0 ml Ask for price

Dnajc11 3'UTR Luciferase Stable Cell Line

TU203519 1.0 ml Ask for price

Dnajc11 3'UTR GFP Stable Cell Line

TU253519 1.0 ml Ask for price

DNAJC11 3'UTR GFP Stable Cell Line

TU056152 1.0 ml
EUR 1521

DNAJC11 3'UTR Luciferase Stable Cell Line

TU006152 1.0 ml
EUR 1521

DNAJC11 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709407 1.0 ug DNA
EUR 316

DNAJC11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709411 1.0 ug DNA
EUR 316

DNAJC11 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709412 1.0 ug DNA
EUR 316

Bovine DnaJ homolog subfamily C member 11, DNAJC11 ELISA KIT

ELI-26869b 96 Tests
EUR 928

Human DnaJ Homolog Subfamily C Member 11 (DNAJC11) ELISA Kit

abx386940-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6097805 3 x 1.0 ug
EUR 376

Human DnaJ homolog subfamily C member 11, DNAJC11 ELISA KIT

ELI-48814h 96 Tests
EUR 824

Mouse DnaJ homolog subfamily C member 11, Dnajc11 ELISA KIT

ELI-48815m 96 Tests
EUR 865

DNAJC11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0615905 3 x 1.0 ug
EUR 376

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4585505 3 x 1.0 ug
EUR 376

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6097806 1.0 ug DNA
EUR 167

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6097807 1.0 ug DNA
EUR 167

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6097808 1.0 ug DNA
EUR 167

DNAJC11 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV709408 1.0 ug DNA
EUR 316

DNAJC11 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV709409 1.0 ug DNA
EUR 374

DNAJC11 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV709410 1.0 ug DNA
EUR 374

DNAJC11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0615906 1.0 ug DNA
EUR 167

DNAJC11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0615907 1.0 ug DNA
EUR 167

DNAJC11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0615908 1.0 ug DNA
EUR 167

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4585506 1.0 ug DNA
EUR 167

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4585507 1.0 ug DNA
EUR 167

Dnajc11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4585508 1.0 ug DNA
EUR 167

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.