Molecules that serve similar functions for different organisms

DNA methylation due to decreased DNMT expression in the postnatal

DNA methylation due to decreased DNMT expression in the postnatal

cdna-clone

The lack of international DNA methylation as a result of decreased DNMT expression within the postnatal mouse ovaries could affiliate with infertility rising throughout ovarian getting old

Ovarian getting old is among the most important causes of feminine infertility, and its molecular background continues to be largely unknown. As DNA methylation regulates many oogenesis/folliculogenesis-related genes, the expression ranges and mobile localizations of DNA methyltransferases (DNMTs) taking part in key functions on this course of is vital within the ovaries from early to aged phrases.
  • Within the current examine, we aimed to guage the spatial and temporal expression of the Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l genes in addition to international DNA methylation ranges within the mouse ovaries throughout getting old.
  • For this function, the next teams have been created: younger (1- and 2-week outdated; n = Three from every week), prepubertal (3- and 4-week-old; n = Three from every week), pubertal (5- and 6-week-old; n = Three from every week), postpubertal (16- and 18-week-old; n = Three from every week), and aged (52-, 60- and 72-week-old; n = Three from every week).
  • We discovered right here that Dnmt1, Dnmt3a, and Dnmt3l genes’ expression at mRNA and protein ranges in addition to international DNA methylation profiles have been regularly and considerably decreased within the postnatal ovaries from younger to aged teams (P < 0.05).
  • In distinction, there was a exceptional enhance of Dnmt3b expression within the pubertal, postpubertal and aged teams (P < 0.05). Our findings counsel that the considerably altered DNMT expression and international DNA methylation ranges throughout ovarian getting old could contribute to feminine infertility improvement on the later phrases of lifespan.
  • Additionally, new researches are required to find out the molecular organic mechanism(s) that how altered DNMT expression and decreased DNA methylation result in ovarian getting old.
Key phrases: DNA methylation; DNA methyltransferase; Infertility; Ovarian getting old
cdna-clone
cdna-clone

Vibrio cholerae PCR kit

PCR-H489-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Vibrio cholerae

Vibrio cholerae PCR kit

PCR-H489-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Vibrio cholerae

Vibrio cholerae O1 Ogawa antibody

10-1341 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa antibody

Vibrio cholerae O1 Ogawa antibody

10-1342 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa antibody

Vibrio cholerae O1 Ogawa antibody

10-1343 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa antibody

Vibrio cholerae O1 Ogawa antibody

10-1344 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa antibody

Vibrio cholerae O1 Inaba antibody

10-1345 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Inaba antibody

Vibrio cholerae O1 Inaba antibody

10-1346 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Inaba antibody

Vibrio cholerae O1 Inaba antibody

10-1347 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Inaba antibody

Vibrio cholerae O1 Inaba antibody

10-1348 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Inaba antibody

Cholera toxin from Vibrio Cholerae

01-511 100ug
EUR 388
Description: The Cholera toxin from Vibrio Cholerae is available in Europe and for worldwide shipping via Gentaur.

Recombinant Vibrio cholerae Toxin B

CK01-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris, 200uM NaCl,pH8.0.

Recombinant Vibrio cholerae Toxin B

CK01-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris, 200uM NaCl,pH8.0.

Recombinant Vibrio cholerae Toxin B

CK01-500ug 500ug
EUR 1755
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris, 200uM NaCl,pH8.0.

Recombinant Vibrio cholerae Toxin B

CK01-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris, 200uM NaCl,pH8.0.

Vibrio cholerae RT PCR kit

RTq-H489-100D 100T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Vibrio cholerae .

Vibrio cholerae RT PCR kit

RTq-H489-150D 150T
EUR 701
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Vibrio cholerae .

Vibrio cholerae RT PCR kit

RTq-H489-50D 50T
EUR 532.8
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Vibrio cholerae .

Vibrio cholerae O1 Ogawa & Inaba antibody

10-1349 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa & Inaba antibody

Vibrio cholerae O1 Ogawa & Inaba antibody

10-1350 1 mg
EUR 462
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa & Inaba antibody

Vibrio cholerae O1 Ogawa & Inaba antibody

10-1351 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa & Inaba antibody

Vibrio cholerae O1 Ogawa & Inaba antibody

10-1352 1 mg
EUR 419
Description: Mouse monoclonal Vibrio cholerae O1 Ogawa & Inaba antibody

Vibrio cholerae Haemolysin (Cholera HlyA) Antibody

abx411680-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Vibrio cholerae One-Step PCR kit

Oneq-H489-100D 100T
EUR 747.4
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Vibrio cholerae.

Vibrio cholerae One-Step PCR kit

Oneq-H489-150D 150T
EUR 838.75
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Vibrio cholerae.

Vibrio cholerae One-Step PCR kit

Oneq-H489-50D 50T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Vibrio cholerae.

Vibrio Cholerae / parahaemoticus / vinificus PCR kit

PCR-MPX632-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Vibrio Cholerae / parahaemoticus / vinificus

Vibrio Cholerae / parahaemoticus / vinificus PCR kit

PCR-MPX632-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Vibrio Cholerae / parahaemoticus / vinificus

Cholera toxin A subunit from Vibrio Cholerae

01-521 50ug
EUR 388
Description: The Cholera toxin A subunit from Vibrio Cholerae is available in Europe and for worldwide shipping via Gentaur.

Cholera toxin B subunit from Vibrio Cholerae

01-525 50ug
EUR 388
Description: The Cholera toxin B subunit from Vibrio Cholerae is available in Europe and for worldwide shipping via Gentaur.

Vibrio cholerae serotype O1 Zona occludens toxin (zot)

1-CSB-EP334425VEX
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Vibrio cholerae serotype O1 Zona occludens toxin(zot) expressed in E.coli

Vibrio cholerae serotype O1 Zona occludens toxin (zot)

1-CSB-YP334425VEX
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Vibrio cholerae serotype O1 Zona occludens toxin(zot) expressed in Yeast

Recombinant Vibrio Cholerae stn Protein (aa 62-78)

VAng-Cr2555-1mgEcoli 1 mg (E. coli)
EUR 2367
Description: Vibrio Cholerae heat-stable enterotoxin ST (stn), recombinant protein.

Recombinant Vibrio Cholerae stn Protein (aa 62-78)

VAng-Cr2555-500gEcoli 500 µg (E. coli)
EUR 1700
Description: Vibrio Cholerae heat-stable enterotoxin ST (stn), recombinant protein.

Recombinant Vibrio Cholerae stn Protein (aa 62-78)

VAng-Cr2555-50gEcoli 50 µg (E. coli)
EUR 1162
Description: Vibrio Cholerae heat-stable enterotoxin ST (stn), recombinant protein.

Recombinant Vibrio Cholerae VC0772 Protein (aa 1-543)

VAng-Cr2556-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase (vibE) (VC0772), recombinant protein.

Recombinant Vibrio Cholerae Sucrase Protein (aa 1-546)

VAng-Cr2557-inquire inquire Ask for price
Description: Vibrio Cholerae probable sucrose-6-phosphate hydrolase, partial (Sucrase), recombinant protein.

Recombinant Vibrio Cholerae VCM66_0196 Protein (aa 1-162)

VAng-Cr2558-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0114 protein VCM66_0196 (VCM66_0196), recombinant protein.

Recombinant Vibrio Cholerae frdD Protein (aa 1-130)

VAng-Cr2563-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain M66-2) fumarate reductase subunit D (frdD), recombinant protein.

Recombinant Vibrio Cholerae VCM66_0079 Protein (aa 1-107)

VAng-Cr2568-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain M66-2) universal stress protein B homolog (uspB) (VCM66_0079), recombinant protein.

Recombinant Vibrio Cholerae vibC Protein (aa 1-395)

VAng-Cr2579-1mgEcoli 1 mg (E. coli)
EUR 4683
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific isochorismate synthase (vibC), recombinant protein.

Recombinant Vibrio Cholerae vibC Protein (aa 1-395)

VAng-Cr2579-500gEcoli 500 µg (E. coli)
EUR 3349
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific isochorismate synthase (vibC), recombinant protein.

Recombinant Vibrio Cholerae vibC Protein (aa 1-395)

VAng-Cr2579-50gEcoli 50 µg (E. coli)
EUR 2273
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific isochorismate synthase (vibC), recombinant protein.

Recombinant Vibrio Cholerae hap Protein (aa 197-609)

VAng-Cr2580-1mgEcoli 1 mg (E. coli)
EUR 4765
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) hemagglutinin/proteinase (hap), recombinant protein.

Recombinant Vibrio Cholerae hap Protein (aa 197-609)

VAng-Cr2580-500gEcoli 500 µg (E. coli)
EUR 3408
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) hemagglutinin/proteinase (hap), recombinant protein.

Recombinant Vibrio Cholerae hap Protein (aa 197-609)

VAng-Cr2580-50gEcoli 50 µg (E. coli)
EUR 2320
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) hemagglutinin/proteinase (hap), recombinant protein.

Recombinant Vibrio Cholerae vibA Protein (aa 1-262)

VAng-Cr2582-1mgEcoli 1 mg (E. coli)
EUR 3853
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (vibA), recombinant protein.

Recombinant Vibrio Cholerae vibA Protein (aa 1-262)

VAng-Cr2582-500gEcoli 500 µg (E. coli)
EUR 2753
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (vibA), recombinant protein.

Recombinant Vibrio Cholerae vibA Protein (aa 1-262)

VAng-Cr2582-50gEcoli 50 µg (E. coli)
EUR 1875
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (vibA), recombinant protein.

Recombinant Vibrio Cholerae A51_B1772 Protein (aa 1-601)

VAng-Cr2583-inquire inquire Ask for price
Description: Vibrio Cholerae NAD (+)--arginine ADP-ribosyltransferase Chelt, partial (A51_B1772), recombinant protein.

Recombinant Vibrio Cholerae VC1459 Protein (aa 1-96)

VAng-Cr2590-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) accessory cholera enterotoxin (ace) (VC1459), recombinant protein.

Recombinant Vibrio Cholerae chxA Protein (aa 33-236)

VAng-Cr2591-1mgEcoli 1 mg (E. coli)
EUR 5514
Description: Vibrio Cholerae cholix toxin (chxA), partial, recombinant protein.

Recombinant Vibrio Cholerae chxA Protein (aa 33-236)

VAng-Cr2591-500gEcoli 500 µg (E. coli)
EUR 3934
Description: Vibrio Cholerae cholix toxin (chxA), partial, recombinant protein.

Recombinant Vibrio Cholerae chxA Protein (aa 33-236)

VAng-Cr2591-50gEcoli 50 µg (E. coli)
EUR 2671
Description: Vibrio Cholerae cholix toxin (chxA), partial, recombinant protein.

Recombinant Vibrio Cholerae hlyB Protein (aa 18-548)

VAng-Cr2592-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) hemolysin secretion protein (hlyB) (VCA0220), recombinant protein.

Recombinant Vibrio Cholerae vibE Protein (aa 1-543)

VAng-Cr2601-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase (vibE), recombinant protein.

Recombinant Vibrio Cholerae zot Protein (aa 1-399)

VAng-Cr2603-1mgEcoli 1 mg (E. coli)
EUR 1828
Description: Vibrio Cholerae serotype O1 zona occludens toxin (zot), recombinant protein.

Recombinant Vibrio Cholerae zot Protein (aa 1-399)

VAng-Cr2603-500gEcoli 500 µg (E. coli)
EUR 1314
Description: Vibrio Cholerae serotype O1 zona occludens toxin (zot), recombinant protein.

Recombinant Vibrio Cholerae zot Protein (aa 1-399)

VAng-Cr2603-50gEcoli 50 µg (E. coli)
EUR 904
Description: Vibrio Cholerae serotype O1 zona occludens toxin (zot), recombinant protein.

Recombinant Vibrio Cholerae exbB1 Protein (aa 1-228)

VAng-Cr2604-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) biopolymer transport protein exbB1 (exbB1) (VCA0911), recombinant protein.

Recombinant Vibrio Cholerae aldA Protein (aa 1-541)

VAng-Cr2605-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) aldehyde dehydrogenase (aldA), partial, recombinant protein.

Recombinant Vibrio Cholerae lacZ Protein (aa 1-1044)

VAng-Cr2613-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) beta-galactosidase (lacZ), partial, recombinant protein.

Recombinant Vibrio Cholerae atpE Protein (aa 1-85)

VAng-Cr2615-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain M66-2) ATP synthase subunit c (atpE), recombinant protein.

Recombinant Vibrio Cholerae tcpD Protein (aa 1-278)

VAng-Cr2619-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) toxin coregulated pilus biosynthesis protein D (tcpD) (VC0833), recombinant protein.

Recombinant Vibrio Cholerae tcpP Protein (aa 1-221)

VAng-Cr2620-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) toxin coregulated pilus biosynthesis protein P (tcpP) (VC0826), recombinant protein.

Recombinant Vibrio Cholerae epsL Protein (aa 1-407)

VAng-Cr2624-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) type II secretion system protein L (epsL) (VC2725), recombinant protein.

Recombinant Vibrio Cholerae epsF Protein (aa 1-406)

VAng-Cr2626-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) type II secretion system protein F (epsF) (VC2731), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0854 Protein (aa 1-248)

VAng-Cr2627-1mgEcoli 1 mg (E. coli)
EUR 3771
Description: Vibrio Cholerae serotype O1 (strain M66-2) probable phosphatase VCM66_A0854 (VCM66_A0854), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0854 Protein (aa 1-248)

VAng-Cr2627-500gEcoli 500 µg (E. coli)
EUR 2694
Description: Vibrio Cholerae serotype O1 (strain M66-2) probable phosphatase VCM66_A0854 (VCM66_A0854), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0854 Protein (aa 1-248)

VAng-Cr2627-50gEcoli 50 µg (E. coli)
EUR 1840
Description: Vibrio Cholerae serotype O1 (strain M66-2) probable phosphatase VCM66_A0854 (VCM66_A0854), recombinant protein.

Recombinant Vibrio Cholerae rstR Protein (aa 1-111)

VAng-Cr2628-1mgEcoli 1 mg (E. coli)
EUR 2940
Description: Vibrio Cholerae cryptic phage CTXphi transcriptional repressor rstR (rstR), recombinant protein.

Recombinant Vibrio Cholerae rstR Protein (aa 1-111)

VAng-Cr2628-500gEcoli 500 µg (E. coli)
EUR 2109
Description: Vibrio Cholerae cryptic phage CTXphi transcriptional repressor rstR (rstR), recombinant protein.

Recombinant Vibrio Cholerae rstR Protein (aa 1-111)

VAng-Cr2628-50gEcoli 50 µg (E. coli)
EUR 1442
Description: Vibrio Cholerae cryptic phage CTXphi transcriptional repressor rstR (rstR), recombinant protein.

Recombinant Vibrio Cholerae VCM66_0563 Protein (aa 1-126)

VAng-Cr2632-1mgEcoli 1 mg (E. coli)
EUR 3022
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0231 protein VCM66_0563 (VCM66_0563), recombinant protein.

Recombinant Vibrio Cholerae VCM66_0563 Protein (aa 1-126)

VAng-Cr2632-500gEcoli 500 µg (E. coli)
EUR 2168
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0231 protein VCM66_0563 (VCM66_0563), recombinant protein.

Recombinant Vibrio Cholerae VCM66_0563 Protein (aa 1-126)

VAng-Cr2632-50gEcoli 50 µg (E. coli)
EUR 1477
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0231 protein VCM66_0563 (VCM66_0563), recombinant protein.

Recombinant Vibrio Cholerae atpA Protein (aa 1-513)

VAng-Cr2634-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) ATP synthase subunit alpha (atpA), partial, recombinant protein.

Recombinant Vibrio Cholerae VCM66_1775 Protein (aa 1-151)

VAng-Cr2635-1mgEcoli 1 mg (E. coli)
EUR 3162
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0225 protein VCM66_1775 (VCM66_1775), recombinant protein.

Recombinant Vibrio Cholerae VCM66_1775 Protein (aa 1-151)

VAng-Cr2635-500gEcoli 500 µg (E. coli)
EUR 2273
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0225 protein VCM66_1775 (VCM66_1775), recombinant protein.

Recombinant Vibrio Cholerae VCM66_1775 Protein (aa 1-151)

VAng-Cr2635-50gEcoli 50 µg (E. coli)
EUR 1548
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0225 protein VCM66_1775 (VCM66_1775), recombinant protein.

Recombinant Vibrio Cholerae maeA Protein (aa 1-562)

VAng-Cr2636-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) NAD-dependent malic enzyme (maeA), partial, recombinant protein.

Recombinant Vibrio Cholerae VCM66_2532 Protein (aa 1-69)

VAng-Cr2637-1mgEcoli 1 mg (E. coli)
EUR 2683
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0270 protein VCM66_2532 (VCM66_2532), recombinant protein.

Recombinant Vibrio Cholerae VCM66_2532 Protein (aa 1-69)

VAng-Cr2637-500gEcoli 500 µg (E. coli)
EUR 1922
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0270 protein VCM66_2532 (VCM66_2532), recombinant protein.

Recombinant Vibrio Cholerae VCM66_2532 Protein (aa 1-69)

VAng-Cr2637-50gEcoli 50 µg (E. coli)
EUR 1314
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0270 protein VCM66_2532 (VCM66_2532), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0911 Protein (aa 1-106)

VAng-Cr2639-1mgEcoli 1 mg (E. coli)
EUR 2905
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0145 protein VCM66_A0911 (VCM66_A0911), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0911 Protein (aa 1-106)

VAng-Cr2639-500gEcoli 500 µg (E. coli)
EUR 2086
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0145 protein VCM66_A0911 (VCM66_A0911), recombinant protein.

Recombinant Vibrio Cholerae VCM66_A0911 Protein (aa 1-106)

VAng-Cr2639-50gEcoli 50 µg (E. coli)
EUR 1431
Description: Vibrio Cholerae serotype O1 (strain M66-2) UPF0145 protein VCM66_A0911 (VCM66_A0911), recombinant protein.

Recombinant Vibrio Cholerae rfbD Protein (aa 1-372)

VAng-Cr2652-1mgEcoli 1 mg (E. coli)
EUR 4543
Description: Vibrio Cholerae probable GDP-mannose 4,6-dehydratase (rfbD), recombinant protein.

Recombinant Vibrio Cholerae rfbD Protein (aa 1-372)

VAng-Cr2652-500gEcoli 500 µg (E. coli)
EUR 3244
Description: Vibrio Cholerae probable GDP-mannose 4,6-dehydratase (rfbD), recombinant protein.

Recombinant Vibrio Cholerae rfbD Protein (aa 1-372)

VAng-Cr2652-50gEcoli 50 µg (E. coli)
EUR 2203
Description: Vibrio Cholerae probable GDP-mannose 4,6-dehydratase (rfbD), recombinant protein.

Recombinant Vibrio Cholerae tcpC Protein (aa 17-489)

VAng-Cr2655-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) toxin coregulated pilus biosynthesis outer membrane protein C (tcpC) (VC0831), recombinant protein.

Recombinant Vibrio Cholerae VCM66_1101 Protein (aa 1-558)

VAng-Cr2656-1mgEcoli 1 mg (E. coli)
EUR 6087
Description: Vibrio Cholerae serotype O1 (strain M66-2) putative transport protein VCM66_1101 (VCM66_1101), recombinant protein.

Recombinant Vibrio Cholerae nqrC Protein (aa 2-257)

VAng-Cr2657-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39541 / Ogawa 395 / O395) Na (+)-translocating NADH-quinone reductase subunit C (nqrC), recombinant protein.

Recombinant Vibrio Cholerae VC2293 Protein (aa 2-257)

VAng-Cr2659-inquire inquire Ask for price
Description: Vibrio Cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) Na (+)-translocating NADH-quinone reductase subunit C (VC2293), recombinant protein.

Recombinant Vibrio Cholerae rpsT Protein (aa 1-86)

VAng-Cr2663-1mgEcoli 1 mg (E. coli)
EUR 2764
Description: Vibrio Cholerae serotype O1 (strain M66-2) 30S ribosomal protein S20 (rpsT), recombinant protein.

Recombinant Vibrio Cholerae rpsT Protein (aa 1-86)

VAng-Cr2663-500gEcoli 500 µg (E. coli)
EUR 1981
Description: Vibrio Cholerae serotype O1 (strain M66-2) 30S ribosomal protein S20 (rpsT), recombinant protein.

Recombinant Vibrio Cholerae rpsT Protein (aa 1-86)

VAng-Cr2663-50gEcoli 50 µg (E. coli)
EUR 1360
Description: Vibrio Cholerae serotype O1 (strain M66-2) 30S ribosomal protein S20 (rpsT), recombinant protein.

Isolation, characterization, and comparative genomic evaluation of a phage infecting high-level aminoglycoside-resistant (HLAR) Enterococcus faecalis

  • nterococcus is a genus of Gram-positive micro organism which might be commensal to the gastrointestinal tracts of people however some species have been more and more implicated as brokers of nosocomial infections. The rise in infections and the unfold of antibiotic-resistant strains have contributed to renewed curiosity within the discovery of Enterococcus phages.
  • The goals of this examine have been (1) the isolation, characterization, and genome sequencing of a phage able to infecting an antibiotic-resistant E. faecalis pressure, and (2) the comparative genomic evaluation of publicly-available Enterococcus phages.
  • For this function, a number of phages have been remoted from wastewater remedy plant (WWTP) influent utilizing a high-level aminoglycoside-resistant (HLAR) E. faecalis pressure because the host. One phage, phiNASRA1, demonstrated a excessive lytic effectivity (∼97.52%).
  • Transmission electron microscopy (TEM) and whole-genome sequencing (WGS) confirmed that phiNASRA1 belongs to the Siphoviridae household of double-stranded DNA viruses. The phage was roughly 250 nm in size and its full genome (40,139 bp, 34.7% GC) contained 62 open studying frames (ORFs).
  • Phylogenetic comparisons of phiNASRA1 and 31 publicly-available Enterococcus phages, based mostly on the big subunit terminase and portal proteins, grouped phage by provenance, measurement, and GC content material. Specifically, each phylogenies grouped phages bigger than 100 kbp into distinct clades.
  • A phylogeny based mostly on a pangenome evaluation of the identical 32 phages additionally grouped phages by provenance, measurement, and GC content material though settlement between the 2 single-locus phylogenies was greater.
  • Per the pangenome phylogeny, phiNASRA1 was most intently associated to phage LY0322 that was comparable in measurement, GC content material, and variety of ORFs (40,139 and 40,934 bp, 34.77 and 34.80%, and 60 and 64 ORFs, respectively).
  • The pangenome evaluation did illustrate the excessive diploma of sequence variety and genome plasticity as no coding sequence was homologous throughout all 32 phages, and even ‘conserved’ structural proteins (e.g., the big subunit terminase and portal proteins) have been homologous in not more than half of the 32 phage genomes.
  • These findings contribute to a rising physique of literature dedicated to understanding phage biology and variety. We suggest that this excessive diploma of variety restricted the worth of the single-locus and pangenome phylogenies.
  • In contrast, the excessive diploma of homology between phages bigger than 100 kbp means that pangenome analyses of extra comparable phages is a viable technique for assessing subclade variety. Future work is targeted on validating phiNASRA1 as a possible therapeutic agent to eradicate antibiotic-resistant E. faecalis infections in an animal mannequin.
Key phrases: Antibiotic resistance; Variety; E. faecalis; Enterococcus; Genomics; Pangenome; Phage.
DNAJB14 Antibody
DF12198 200ul
EUR 304
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.
DNAJB14 Antibody
1-CSB-PA007007GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
DNAJB14 Polyclonal Antibody
30628-100ul 100ul
EUR 252
DNAJB14 Polyclonal Antibody
30628-50ul 50ul
EUR 187
DNAJB14 Polyclonal Antibody
A66234 100 µg
EUR 570.55
Description: reagents widely cited
anti- DNAJB14 antibody
FNab02446 100µg
EUR 505.25
  • Immunogen: DnaJ(Hsp40) homolog, subfamily B, member 14
  • Uniprot ID: Q8TBM8
  • Gene ID: 79982
  • Research Area: Metabolism
Description: Antibody raised against DNAJB14
Anti-DNAJB14 antibody
PAab02446 100 ug
EUR 355
Anti-DNAJB14 antibody
STJ27008 100 µl
EUR 277
DNAJB14 siRNA
20-abx914343
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNAJB14 siRNA
20-abx914344
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNAJB14 Antibody, HRP conjugated
1-CSB-PA819454LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DNAJB14 Antibody, FITC conjugated
1-CSB-PA819454LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DNAJB14 Antibody, Biotin conjugated
1-CSB-PA819454LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
DNAJB14 Polyclonal Conjugated Antibody
C30628 100ul
EUR 397
DNAJB14 Blocking Peptide
DF12198-BP 1mg
EUR 195
DNAJB14 cloning plasmid
CSB-CL819454HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa
  • Show more
Description: A cloning plasmid for the DNAJB14 gene.
DNAJB14 Rabbit pAb
A4990-100ul 100 ul
EUR 308
DNAJB14 Rabbit pAb
A4990-200ul 200 ul
EUR 459
DNAJB14 Rabbit pAb
A4990-20ul 20 ul
EUR 183
DNAJB14 Rabbit pAb
A4990-50ul 50 ul
EUR 223
DNAJB14 Polyclonal Antibody, HRP Conjugated
A66235 100 µg
EUR 570.55
Description: Ask the seller for details
DNAJB14 Polyclonal Antibody, FITC Conjugated
A66236 100 µg
EUR 570.55
Description: The best epigenetics products
DNAJB14 Polyclonal Antibody, Biotin Conjugated
A66237 100 µg
EUR 570.55
Description: kits suitable for this type of research
DNAJB14 ELISA KIT|Human
EF009156 96 Tests
EUR 689
Mouse DNAJB14 shRNA Plasmid
20-abx977260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DNAJB14 shRNA Plasmid
20-abx962706
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DNAJB14 Recombinant Protein (Human)
RP009529 100 ug Ask for price
DNAJB14 Recombinant Protein (Rat)
RP198299 100 ug Ask for price
DNAJB14 Recombinant Protein (Mouse)
RP129476 100 ug Ask for price
Dnajb14 ORF Vector (Rat) (pORF)
ORF066101 1.0 ug DNA
EUR 506
DNAJB14 ORF Vector (Human) (pORF)
ORF003177 1.0 ug DNA
EUR 95
Dnajb14 ORF Vector (Mouse) (pORF)
ORF043160 1.0 ug DNA
EUR 506
DNAJB14 sgRNA CRISPR Lentivector set (Human)
K0614501 3 x 1.0 ug
EUR 339
Dnajb14 sgRNA CRISPR Lentivector set (Rat)
K6216401 3 x 1.0 ug
EUR 339
Dnajb14 sgRNA CRISPR Lentivector set (Mouse)
K4586901 3 x 1.0 ug
EUR 339
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx003806
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx112129
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
20-abx302018
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody
abx232446-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K0614502 1.0 ug DNA
EUR 154
DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K0614503 1.0 ug DNA
EUR 154
DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K0614504 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6216402 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6216403 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6216404 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4586902 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4586903 1.0 ug DNA
EUR 154
Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4586904 1.0 ug DNA
EUR 154
DNAJB14 Protein Vector (Mouse) (pPB-C-His)
PV172638 500 ng
EUR 603
DNAJB14 Protein Vector (Mouse) (pPB-N-His)
PV172639 500 ng
EUR 603
DNAJB14 Protein Vector (Mouse) (pPM-C-HA)
PV172640 500 ng
EUR 603
DNAJB14 Protein Vector (Mouse) (pPM-C-His)
PV172641 500 ng
EUR 603
DNAJB14 Protein Vector (Rat) (pPB-C-His)
PV264402 500 ng
EUR 603
DNAJB14 Protein Vector (Rat) (pPB-N-His)
PV264403 500 ng
EUR 603
DNAJB14 Protein Vector (Rat) (pPM-C-HA)
PV264404 500 ng
EUR 603
DNAJB14 Protein Vector (Rat) (pPM-C-His)
PV264405 500 ng
EUR 603
DNAJB14 Protein Vector (Human) (pPB-C-His)
PV012705 500 ng
EUR 329
DNAJB14 Protein Vector (Human) (pPB-N-His)
PV012706 500 ng
EUR 329
DNAJB14 Protein Vector (Human) (pPM-C-HA)
PV012707 500 ng
EUR 329
DNAJB14 Protein Vector (Human) (pPM-C-His)
PV012708 500 ng
EUR 329
Dnajb14 3'UTR GFP Stable Cell Line
TU155250 1.0 ml Ask for price
Dnajb14 3'UTR Luciferase Stable Cell Line
TU105250 1.0 ml Ask for price
Dnajb14 3'UTR Luciferase Stable Cell Line
TU203509 1.0 ml Ask for price
Dnajb14 3'UTR GFP Stable Cell Line
TU253509 1.0 ml Ask for price
DNAJB14 3'UTR GFP Stable Cell Line
TU056138 1.0 ml
EUR 2333
DNAJB14 3'UTR Luciferase Stable Cell Line
TU006138 1.0 ml
EUR 2333
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)
20-abx308795
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)
20-abx308796
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)
20-abx308797
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-26399h 96 Tests
EUR 824
Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT
ELI-08275m 96 Tests
EUR 865
Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit
abx386930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT
ELI-31942b 96 Tests
EUR 928
DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0614505 3 x 1.0 ug
EUR 376
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6216405 3 x 1.0 ug
EUR 376
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4586905 3 x 1.0 ug
EUR 376
DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0614506 1.0 ug DNA
EUR 167
DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0614507 1.0 ug DNA
EUR 167
DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0614508 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6216406 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6216407 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6216408 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4586906 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4586907 1.0 ug DNA
EUR 167
Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4586908 1.0 ug DNA
EUR 167
H2B Antibody Antibody
AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.
CD11b Antibody Antibody
ABD2911 100 ug
EUR 438
anti- Antibody^Polyclonal antibody control antibody
LSMab09882 100 ug
EUR 438
Ly1 Antibody Reactive (LYAR) Antibody
20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Anti-Glycolipid Antibody (AGA) Antibody
20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Anti-Glycolipid Antibody (AGA) Antibody
abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *